![]() |
Cloning and analysing of 5' flanking region of Xenopus organizer gene noggin
TAO Qin Hua, Jing YANG, Wen Yan MEI, Xin GENG,
Xiao Yan DING*
Shanghai Institute of Cell Biology, CAS, Shanghai
200031, China
ABSTRACT
Xenopus organizer
specific gene Noggin possesses nearly all the characterestic properties
of the action of organizer to specify the embryonic body axis. To analyze how
the maternal inherited factors control its expression pattern, we cloned the 5'
regulatory region of noggin gene. The 1.5 kb upstream sequense could
direct reporter gene to express in vivo and data from deletion analysis
indicated that a 229 base pair fragmet is essential for activating noggin
expression. We further demonstrated that the response elements within this
regulatory region were indeed under the control of growth factor activin
and Wnt signaling pathway components.
Key words: Xenopus,
organizer specific gene, noggin, regulatory region
INTRODUCTION
The dorsal blastopore lip of Xenopus early gastrulae plays a key role in specifying the body axis. Transplanting a small piece of dorsal lip into the ventral side of another embryo causes the formation of a secondary axis, resulting in a twinned embryo and thus, the dorsal lip of blastopore is named ``the organizer"[1]. Due to the functional importance of the organizer, intense efforts have been placed on deciphering its molecular properties and in past decades dozens of organizer genes have been identified(reviewed by Heasman J[2]).
The organizer is progressively induced during blastula stage by maternal inducing signals. It's generally accepted that mesoderm-inducing signals and dorsal determinants are both necessary for the formation of the organizer[2]. The most promising candidates of mesoderm-inducing signals are factors encoded by genes of the members of transforming growth factor-beta (activin, Vg1, BMP-4, nodal related genes etc.) and fibroblast growth factor super families[3],[4]. Increasing evidence also revealed that components of Wnt signaling pathway have been implicated in dorsalization of mesoderm[2]. These two kinds of maternal signals orchestrated in the vegetal dorsal territories of blastula, resulting in the establishment of the organizer. However, how these maternal inherited factors induce the formation of the organizer, in terms of initiating the expression of organizer spesific genes, remains unclear.
NOGGIN, a secreted factor, is expressed in
the organizer region during gastrulation and has nearly all characterestic
properties of the organzier, such as in patterning body axis, dorsalizing
ventral mesodrm and converting prospective ectoderm to neural ectoderm. It can
also induce an imcomplete additional body axis when mis-expressed in ventral
marginal zone[5]. Therefore, to analyze the regulation of noggin
expression will help greatly in understanding the establishment of the
organizer. To this aim, we cloned a 1.5 kb noggin 5' upstream DNA by
screening a partial Xenopus genomic library. Reporter gene assays
indicated that this genomic sequence was able to direct reporter gene to express
in vivo and respond to activin and Wnt signalings.
Furthermore, a 229 bp fragment has been identified to be essential for the basal
promoter activity by serial deletion analysis.
MATERIALS AND METHODS
Isolation of Xenopus noggin genomic sequence
Xenopus genomic DNA were digested with EcoRI and fractionated by 0.7 % agarose gel, then recovered according to molecular weight ladder (1-2, 5-6kb, and over than 6 kb. A pair of PCR primers specific to noggin 5' untranslated region (UTR) was used to probe the genomic fragments. Since the positive signal was detected in the 2-3 kb genomic fragments with the highest abundance(see Fig 1A), a special library containing the EcoRI digested 2-3 kb genomic fragments was constructed in pBluescript II SK- vector for further screening. By using the probe amplified from the 5' UTR of noggin cDNA, one positive clone was screened out from about 200,000 transformants. Sequencing result indicated that the positive insert was 2066 base pair covering 516 base pair 5' UTR of noggin cDNA and 1550 bp 5' flanking region. The positive clone was therefore named pSK-N2066. PCR primers specific to noggin 5' cDNA are as follows.
foreward: 5'actttctctggttgcatccc 3'; reverse: 5'
acctagcgaattggggattc 3'.
Construction of expression plasmids
Functional beta-galactosidase gene was cloned from pCH110 (phamarcia) with BamHI/HindIII (blunted) into pSK-N2066 with BamHI/SmaI. This reporter construct was named 2066-LacZ.
1556bp 5' flanking region was amplified from pSK-N2066 by
PCR with T7 primer and noggin specific primer 5' gcctggctaatggatcctaagtagcc
3' (1545-1570 bp in Fig 1B, introducing a BamHI site by substituting aa with gg
bases for cloning convenience), and inserted into pBluescript SK- vector with
EcoRI/ BamHI sites. The resultant was named pSK-N1556. Serial deletions were
obtained by the following processes: pSK-N1556 were double digested with either
EcoRI/NdeI, EcoRI/StuI, EcoRI/HindIII or HindIII/StuI, blunted by Klenow and
then religated, resulting in serial deletions: pSK-N797, pSK-N657, pSK-N329 and
pSK-N1556(-229). The 1556 bp 5' flanking fragment and its serial deletions were
then cloned into firefly luciferase based pGL3-basic with KpnI/BamHI and KpnI/BglII
sites, and respectively named as 1556-Luc, 797-Luc, 657-Luc, 329-Luc and
1556(-229)-Luc.
Preparation of synthetic RNA
The plasmid psp64T-activin bb (a
gift from Harland RM) was linearized with XbaI and transcripted by SP6 RNA
polymerase, pCDNA1.1-ArmdNXTcf-3 (a gift from Roose J), which encodes the
fusion protein containing the activation domain (694-844 aa) of Drosophila
Armadillo and N-terminus (1-31 aa) deleted Tcf-3 of Xenopus, and has the
constitutive dorsalizing activitiy, was linearized with XbaI and transcripted by
T7 RNA polymerase. Both reactions were carried out with cap analog/GTP ratio
5:1.
Beta-galactosidase staining and luciferase assay
Albino Xenopus embryos injected with beta-galactosidase reporter gene were fixed at various stages, and stained with X-Gal. The staining procedure was described previously[6].
For dual-luciferase reporter assays, animal caps and
embryos were collected and excess medium was removed. Each sample was
triplicated. 10 ml of 1 ?Passive Lysis Buffer per animal cap or per whole embryo
was added to homogenize the samples, and 10 ml of lysate was used to do
luminescence measurement (See details in Dual-Luciferase reporter gene assay
system user book, Promega)
Handling and manipulation of embryos
All embryos were obtained by artificial insemination, de-jellied in 2 % cystein-Cl-(pH 7.8), reared in 0.1 ?modified Barth saline (MBS) or with additional 1 % Ficoll 400( Sigma) for microinjection, and staged according to Nieuwkoop and Faber (1967)[7]. In beta-galactosidase reporter assay, albino embryos were used.
For promoter activity assay, dual-luciferase reporter gene assay system (Promega) was used. Luciferase reporter constructs combining with internal control pRL-SV40 (1:5 in concentration) were injected at 4 to 8 -cell stage in dorsal marginal zone. Injected embryos were harvested at stage 10.5 for luminescence measurement. For animal cap assays, dual-luciferase reporter genes were injected either with or without 1-2 pg mRNA of interests (actvin or ArmdNXTcf-3) at 2-cell stage in animal pole. The animal caps were dissected at stage 8 and reared in 1 ?MBS to stage 10.5 for luminescence measurement.
All injected embryos were reared in 0.1 % Ficoll, 0.1 ?MBS
till stage 7, then transferred to 0.1 ?MBS for further incubation.
RESULTS AND DISCUSSION
Isolation of 5' flanking region of Xenopus organizer gene noggin
A 2066 bp long genomic sequence was obtained from a special fractionated genomic library by a noggin 5' UTR specific probe (see details in Materials and Methods). Sequencing indicated that this genomic sequence covered 516 bp of 5' UTR and 1550 bp of 5' flanking region.
The promoter activity of this genomic
fragment was examined by injecting reporter construct 2066-LacZ at 2-cell stage
in marginal zone of one cell. In reporter construct 2066-LacZ, the functional
betagalactosidase gene was inserted immediately downstream to 2066 bp of genomic
fragment. X-Gal staining through gastrula to taibud stages embryos demonstraed
that the 2066 bp of noggin genomic fragment was indeed able to direct
reporter gene to express in vivo, i.e. the noggin genomic fragment
we cloned could respond to in vivo signals. Four injected embryos at late
neurula stge were shown in Fig 2, demonstrating the reporter gene was expressed
primarily in dorsal territories. 1.5kb noggin5'regulatory
region is able to respone to mesoderm induction signal activin and signals
| Fig
1. The cloned noggin 5' regulatory region and its promoter activity A. 5' flanking region located in 2-3 kb genomic fractionate (lane 2) with the highest abundance. Lane 1-5 showing the respective PCR results of EcoRI digesteted genomic fragments with 1-2, 2-3, 5-6 kb molecular weight size. Lane 6, EcoRI digested genomic DNA mixture control; Lane 7, genomic control; lane 8, molecular weight standards. B. 2066 bp 5' upstrem sequence of noggin, including 1550 bp regulatory sequence and 516 bp untranslated region(italics). Two classical TATA boxes are found (1034 bp and 1234 bp). Restriction endonucleases used for subcloning are indicated. |
|||||||||||
|
¡ Cell Research Online (CRO) published bimonthly ¡¡¡¡ copyrighted©2003 journal of Cell Research suggested resolution 1024*768
|